

Bowtie is an ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of over 25 million 35-bp reads per hour. Bowtie indexes the genome with a Burrows-Wheeler index to keep its memory footprint small: typically about 2.2 GB for the human genome (2.9 GB for paired-end).

Versions and Availability

▶ Display Softenv Keys for bowtie on all clusters
Machine Version Softenv Key
None Available N/A N/A
▶ Softenv FAQ?

The information here is applicable to LSU HPC and LONI systems.


SoftEnv is a utility that is supposed to help users manage complex user environments with potentially conflicting application versions and libraries.

System Default Path

When a user logs in, the system /etc/profile or /etc/csh.cshrc (depending on login shell, and mirrored from csm:/cfmroot/etc/profile) calls /usr/local/packages/softenv-1.6.2/bin/ to set up the default path via the SoftEnv database.

SoftEnv looks for a user's ~/.soft file and updates the variables and paths accordingly.

Viewing Available Packages

Using the softenv command, a user may view the list of available packages. Currently, it can not be ensured that the packages shown are actually available or working on the particular machine. Every attempt is made to present an identical environment on all of the LONI clusters, but sometimes this is not the case.


$ softenv
These are the macros available:
*   @default
These are the keywords explicitly available:
+amber-8                       Applications: 'Amber', version: 8 Amber is a
+apache-ant-1.6.5              Ant, Java based XML make system version: 1.6.
+charm-5.9                     Applications: 'Charm++', version: 5.9 Charm++
+default                       this is the default environment...nukes /etc/
+essl-4.2                      Libraries: 'ESSL', version: 4.2 ESSL is a sta
+gaussian-03                   Applications: 'Gaussian', version: 03 Gaussia
Listing of Available Packages

See Packages Available via SoftEnv on LSU HPC and LONI.

For a more accurate, up to date list, use the softenv command.


Currently there are some caveats to using this tool.

  1. packages might be out of sync between what is listed and what is actually available
  2. resoft and soft utilities are not; to update the environment for now, log out and login after modifying the ~/.soft file.

softenv is available on all LSU HPC and LONI clusters to all users in both interactive login sessions (i.e., just logging into the machine) and the batch environment created by the PBS job scheduler on Linux clusters and by loadleveler on AIX clusters..

Packages Availability

This information can be viewed using the softenv command:

% softenv
Managing Environment with SoftEnv

The file ~/.soft in the user's home directory is where the different packages are managed. Add the +keyword into your .soft file. For instance, ff one wants to add the Amber Molecular Dynamics package into their environment, the end of the .soft file should look like this:



To update the environment after modifying this file, one simply uses the resoft command:

% resoft
▶ Display Module Names for bowtie on all clusters.
Machine Version Module
qb 1.0.0 bowtie/1.0.0/INTEL-14.0.2
smic 1.0.0 bowtie/1.0.0/INTEL-14.0.2
smic 1.1.1 bowtie/1.1.1/INTEL-14.0.2
philip 1.1.1 bowtie/1.1.1/INTEL-15.0.3
▶ **FIX-ME** FAQ?


bowtie --help  for command line options

e.g., bowtie -c prefix-index-file GCGTGAGCTATGAGAAAGCGCCACGCTTCC
      bowtie prefix-index-file reads.fq

      bowtie-build seq.fna index-file  


Last modified: June 20 2015 11:20:48.