bowtie

About

Bowtie is an ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of over 25 million 35-bp reads per hour. Bowtie indexes the genome with a Burrows-Wheeler index to keep its memory footprint small: typically about 2.2 GB for the human genome (2.9 GB for paired-end).

Versions and Availability

Module Names for bowtie on qb2
Machine Version Module Name
None Available N/A N/A
▶ **FIX-ME** FAQ?

Usage

bowtie --help  for command line options

e.g., bowtie -c prefix-index-file GCGTGAGCTATGAGAAAGCGCCACGCTTCC
      bowtie prefix-index-file reads.fq

      bowtie-build seq.fna index-file  
   

Resources

Last modified: June 20 2015 11:20:48.