

Bowtie2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters, and particularly good at aligning to relatively long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 GB. Bowtie 2 supports gapped, local, and paired-end alignment modes.

Versions and Availability

Module Names for bowtie2 on qb2
Machine Version Module Name
None Available N/A N/A
▶ **FIX-ME** FAQ?


bowtie --help  for command line options

e.g., bowtie2 -c prefix-index-file GCGTGAGCTATGAGAAAGCGCCACGCTTCC
      bowtie2 prefix-index-file reads.fq

      bowtie2-build seq.fna index-file 


Last modified: June 20 2015 11:20:48.